Blog Post
Enzymatic DNA synthesis:
Turning a lab concept into an industrial solution Part 3 - First application
DNA Script proved that its enzymatically synthesized DNA is biologically functional with a PCR experiment.
The ability to write DNA efficiently is a key necessity for almost all applications in the life science industry. DNA synthesis enables the engineering of biological systems (enzymes, antibodies, bacteria, yeast, plants, cells, etc.) to create new applications, most notably in biotherapeutics, the production of chemicals and materials, agriculture or nanotechnology.

DNA Script is developing a novel enzymatic technology to synthesize DNA that will increase performance in strand length, purity, turnaround time and cost. This blog series reports key technological milestones — initially revealed at the GP-write Conference in May 2018 — which demonstrate the potential of enzymatic synthesis, even at this early phase in the development of our technology.

What to do with enzymatically synthesized primers? First example: PCR

Attaining synthesis of 50-nucleotide strands of DNA is a significant milestone, but we believe using our enzymatically synthesized primers in real conditions is even more important. The result below shows the first successful PCR performed using two enzymatically synthesized primers.
T7 forward: TAATACGACTCACTATAGGG
T7 reverse: GCTAGTTATTGCTCAGCGG
Those primers were used to amplify a 373bp insert in a plasmid.
Fig. 1 - In this experiment we synthesized two primers enzymatically: T7 forward (Enz f) and T7 reverse (Enz r) that are shown on the gel on the right. We ordered the same sequences from classical suppliers (Chem f and Chem r respectively) and performed 6 different PCR amplifications of a 373bp insert with different primers.
The gel shows successful PCR with DNA Script primers.
We believe the way this experiment was performed is significant: the primers were synthesized in the morning without any human supervision, and the PCR was performed the afternoon. We did not purify our primers, and we performed the PCR directly after synthesis, without any post-processing, as synthesis is performed in aqueous conditions. This streamlined process is at the core of DNA Script's vision.

An exciting road forward - be part of it!

The results presented in the last two posts are merely milestones for our company and our technology: our end goal is to ease the work of synthetic biologists by removing the "Build" challenge in their projects. The company's goal is to excel over phosphoramidite chemistry in less than a year.

Before hitting that mark, we will be shipping our first DNA fragments to alpha testers in the coming months to have our DNA tested in as many real-life applications as possible.

If you want to be part of this alpha program, or if you have some unmet needs in DNA synthesis, don't hesitate to reach out at: contact@dnascript.co.
JUNE,14th 2018